Pair programming.
On this assignment, just like the last one,
you are encouraged (not required) to work with
a partner provided you practice pair programming
(same rules as last assignment).
|
|
What are the main goals of this assignment? Use a symbol table, learn about natural language processing, and learn about Markov models.
What is the origin of the Markov text generator? It was first described by Claude Shannon in 1948. The first computer version was apparently written by Don P. Mitchell, adapted by Bruce Ellis, and popularized by A. K. Dewdney in the Computing Recreations section of Scientific American. Brian Kernighan and Rob Pike revived the program in a University setting and described it as an example of design in The Practice of Programming. The program is also described in Jon Bentley's Programming Pearls.
Do I have to implement the prescribed API? Yes, or you will lose a substantial number of points.
How do I read in the input text from standard input? Use StdIn.readAll().
Given a string s, is there an efficient way to extract a substring? Use s.substring(i, i+k) to get the k-character substring starting at i. In Java, this operation takes constant time, regardless of the size of k.
How do I emulate the behavior of a circular string? There are a number of approaches. One way is to concatenate the first k characters to the end of the input text.
How do I convert a char to an int? A char is a 16-bit (unsigned) integer. Java will automatically promote a char to an int if you use it as an index into an array.
My rand() method calls StdRandom.discrete() as recommended in the Possible Progress Steps, but I get the following error message when I run: java.lang.AssertionError. What does that mean? It means that the probabilities don't sum up to 1. Double check how you are computing the values for the array you send to StdRandom.discrete(). The array elements are the probabilities of each possible event, so the sum of the array elements should be 1. (To learn how to use assertions, see pp. 446-447.)
Should my program generate a different output each time I run it? Yes.
My random text ends in the middle of a sentence. Is that OK? Yes, that's to be expected. We recommend adding a StdOut.println(); statement after the last character you print out.
For which values of k should my program work? It should work for all well-defined values of k from and including 0 to and including the length of the input text. Naturally, as k gets larger, your program will use more memory and take longer.
I get an OutOfMemoryException. How do I tell Java to use more of my computer's memory? Depending on your operating system, you may have to ask the Java Virtual Machine for more main memory beyond the default.
The 100m means 100MB, and you should adjust this number depending on the size of the input text.% java -Xmx100m TextGenerator 7 1000 < input.txt
|
|
Thoroughly test your MarkovModel. We provide a main() as a start to your testing.
public static void main(String[] args) {
MarkovModel mod1 = new MarkovModel("i am sam. sam i am", 3);
StdOut.println("freq(\"sam\", ' ') = " + mod1.freq("sam", ' '));
StdOut.println("freq(\"sam\", '.') = " + mod1.freq("sam", '.'));
StdOut.println("freq(\"mi \") = " + mod1.freq("mi "));
StdOut.println("freq(\"sam\") = " + mod1.freq("sam"));
StdOut.println();
String text = "now is the time. now is the time to eat. "
+ "now is the time to live.";
MarkovModel mod2 = new MarkovModel(text, 7);
StdOut.println("freq(\"now is\", ' ') = " + mod2.freq("now is ", ' '));
StdOut.println("freq(\"now is\", 't') = " + mod2.freq("now is ", 't'));
StdOut.println("freq(\"now is\") = " + mod2.freq("now is "));
}
%java MarkovModel
freq("sam", ' ') = 1
freq("sam", '.') = 1
freq("mi ") = 1
freq("sam") = 2
freq("now is", ' ') = 0
freq("now is", 't') = 3
freq("now is") = 3
Note that this does not test your rand() method. You can use print statements to test rand() to make sure that each non-zero entry of the array passed to StdRandom.discrete() is accurate. (But make sure to remove these print statements before submitting your code.)
An order-0 Markov model generates a random sequence of letters where each letter appears with probability proportional to its frequency in the input text. For input17.txt there are 9 g's, 7 a's, and 1 c. So we want the probability of generating a 'g' to be 9/17, an 'a' to be 7/17, and a 'c' to be be 1/17. In a sequence of 100 characters, we'd therefore expect on average about 53 g's, 41 a's, and 6 c's.
% java TextGenerator 0 100 < input17.txt gaaagaacagcagacgacggaagaaggaggaaaaggaggggaggggggaggaggaagggagaaaggagacagcggaggggacgggaggagaggaggagag
For input17.txt, the next character after "ga" is 'a' with probability 1/5 and 'g' with probability 4/5. If you run the following command 10 times, you should expect (on average) to see "gag" 8 times and "gaa" 2 times.
% java TextGenerator 2 3 < input17.txt gag
|
|
These are purely suggestions for how you might make progress. You do not have to follow these steps.
|
|